View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4632-Insertion-7 (Length: 135)
Name: NF4632-Insertion-7
Description: NF4632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4632-Insertion-7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 24909159 - 24909033
Alignment:
| Q |
8 |
ctcttacattttggatattcactttgttttacttgaaagatcatttaagaactcaaagcctttgatcttcaatttgattttatcaaaggattaaagtgtc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
24909159 |
ctcttacattttggatattcactttgttttacttgaaagatcatttaagaacttaaagcctttgatcttcaatttgattttattaaaggattgaagtgtc |
24909060 |
T |
|
| Q |
108 |
ttgacaatttctttggagtcttcctta |
134 |
Q |
| |
|
| ||||||||||||||||||||||||| |
|
|
| T |
24909059 |
tagacaatttctttggagtcttcctta |
24909033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University