View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4632_high_2 (Length: 384)
Name: NF4632_high_2
Description: NF4632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4632_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 244
Target Start/End: Original strand, 38324251 - 38324479
Alignment:
| Q |
13 |
cagagacttgtgtagactggtatgtcttatgaggaggagcagagatggacaccaaacacgaattttgagtgcccaacattgttggacacgccttcagttt |
112 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38324251 |
cagaaacttgtgtagactgttatgtcttatga--agga-cagaaatggacaccaaacacgaattttgagtgcccaacattgttggacacaccttcagttt |
38324347 |
T |
|
| Q |
113 |
aaaatatcggtgttacaagtgttaagaagtgcactcaaatgcagccttggctcccctctgagagagggaaactttgcaggcatcagattaatcacacact |
212 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38324348 |
aaaatatcggtgttacaagtgtaaataagtgcactcaaatgcagccttggctcccctctgagagagggaaactttgcaggcatcagattaatcacacact |
38324447 |
T |
|
| Q |
213 |
tcttctgtatcaatgtaagtttctttgctgcc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38324448 |
tcttctgtatcaatgtaagtttctttgctgcc |
38324479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 306 - 384
Target Start/End: Original strand, 38325284 - 38325362
Alignment:
| Q |
306 |
gcaaattctaattggctaggtttaagaacaatgacggtaaccaatacaatatacttcaaagtaatcaatgactaaaaca |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38325284 |
gcaaattctaattggctaggtttaagaacaatgactgtaaccaatacaatatacttcaaagtaatcaatgactaaaaca |
38325362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University