View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4632_high_7 (Length: 313)
Name: NF4632_high_7
Description: NF4632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4632_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 3048045 - 3047911
Alignment:
| Q |
1 |
taatagcaacacaattttatggtttgaatcaatctgaaccattggattcatttacttcgtgaatgcgtccaaattagattattaagaatcctaacacaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3048045 |
taatagcaacacaattttatggtttgaatcaatctgaaccattggattcatttacttcgtgaatgcgtccaaattagattattaagaatcctaacacaag |
3047946 |
T |
|
| Q |
101 |
aaggacatactcaactcaagcaattatgctttgtc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3047945 |
aaggacatactcaactcaagcaattatgctttgtc |
3047911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 186 - 313
Target Start/End: Complemental strand, 3047860 - 3047733
Alignment:
| Q |
186 |
tttggttaaaaacggaaaagtaatcatgtgagcttgccgaaagaggaagtatggtttccaaattcttgtttttggtcgtacaaatgattgttgtatagcc |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3047860 |
tttggttaaaaacggaaaagtaatcatgtgagcttgccgaaagaggaagtatagtttccaaattcttgtttttggtcgtacaaatgattgttgtatagcc |
3047761 |
T |
|
| Q |
286 |
ataattccttttctaattccttttgtta |
313 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
3047760 |
ataattctttttctaattccttttgtta |
3047733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University