View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4633-Insertion-14 (Length: 172)
Name: NF4633-Insertion-14
Description: NF4633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4633-Insertion-14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 9e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 8 - 171
Target Start/End: Original strand, 50985951 - 50986114
Alignment:
| Q |
8 |
catagtttatataaagaggtagacatgtagtagtagcagttcatataaaagtatcacttgaatgagcttcgaattcaggttagaagactgcccaccctaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
50985951 |
catagtttatataaagaggtagacatgtagtagtagcagttcatataaaagtatcacttgaatgagcttcgaattcagtttagaagactgcccaccttaa |
50986050 |
T |
|
| Q |
108 |
cactatgtttccatcttcaaataaataggacggatccagctcaatcggacggcttattggaatt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50986051 |
cactatgtttccatcttcaaataaataggacggatccagctcaatcggacggcttcttggaatt |
50986114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 8 - 171
Target Start/End: Original strand, 51089085 - 51089248
Alignment:
| Q |
8 |
catagtttatataaagaggtagacatgtagtagtagcagttcatataaaagtatcacttgaatgagcttcgaattcaggttagaagactgcccaccctaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
51089085 |
catagtttatataaagaggtagacatgtagtagtagcagttcatataaaagtatcacttgaatgagcttcgaattcagtttagaagactgcccaccttaa |
51089184 |
T |
|
| Q |
108 |
cactatgtttccatcttcaaataaataggacggatccagctcaatcggacggcttattggaatt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51089185 |
cactatgtttccatcttcaaataaataggacggatccagctcaatcggacggcttcttggaatt |
51089248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University