View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4633-Insertion-16 (Length: 135)
Name: NF4633-Insertion-16
Description: NF4633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4633-Insertion-16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 1e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 9 - 99
Target Start/End: Complemental strand, 16641770 - 16641681
Alignment:
| Q |
9 |
aacatgctctcctttttgggttgagggtattgctgcattgaattgaaactgttatacaggtttctagagttcatagcataacatgctctcc |
99 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16641770 |
aacatgctctcctttttggct-gagggtattgctgaattgcattgaaactgttatacaggtttctagagttcatagcataacatgctctcc |
16641681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 4e-30
Query Start/End: Original strand, 9 - 99
Target Start/End: Complemental strand, 16632667 - 16632578
Alignment:
| Q |
9 |
aacatgctctcctttttgggttgagggtattgctgcattgaattgaaactgttatacaggtttctagagttcatagcataacatgctctcc |
99 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
16632667 |
aacatgctctcctttttggct-gagggtattgctgcattgcattgaaactgttatacatgtttctagagttcatagtataacatgctctcc |
16632578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University