View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4633_high_4 (Length: 328)
Name: NF4633_high_4
Description: NF4633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4633_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 7 - 309
Target Start/End: Original strand, 24926522 - 24926824
Alignment:
| Q |
7 |
tagattatactgatggagagatgccacgtgactgcaccggattcttagcaacaacaggccgtgcttttgatgttgatgaaggtcgagtaggaggagcaga |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24926522 |
tagattttactgatggagagatgccacgtgactgcaccggattcttagcaacaacagggcgtgcttttgatgttgatgaaggtcgagtaggaggagcaga |
24926621 |
T |
 |
| Q |
107 |
tactccaaatgtcctcgaaggtgttgatgatcgaatattaggagttgctgatctttgagatgtcttaggagctgtcaaggaaggccttgaagtaggtgtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24926622 |
tactccaaatgtcctcgaaggtgttgatgatcgaatattaggagttgctgatctttgagatgtcttaggagctgtcaaggaaggccttgaagtaggtgtt |
24926721 |
T |
 |
| Q |
207 |
gaggccctcgaagcgggtctagtgggagttgatgatctcactggtggagctgtagacttcgtagaagttaatgtggcccgcgaggtaggcgtagagggcc |
306 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24926722 |
gaggccctcgaagtgggtctagtgggagttgatgatctcactggtggagctgtagacttcgtagaagttaatgtggcccgcgaggtaggcgtagagggcc |
24926821 |
T |
 |
| Q |
307 |
tcg |
309 |
Q |
| |
|
||| |
|
|
| T |
24926822 |
tcg |
24926824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University