View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4634_high_7 (Length: 239)
Name: NF4634_high_7
Description: NF4634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4634_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 24361576 - 24361782
Alignment:
| Q |
15 |
ttctagaggaaagcagtctttaaaaactataagagaagtttaaattatagttatgcatacatgctttatagaaactgaaatgtgacttacaaagtggaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24361576 |
ttctagaggaaagcagtctttaaaaactataagagaagtttaaattatagttatgcatacatgctttatagaaactgaaatgtgacttacaaagtggaaa |
24361675 |
T |
|
| Q |
115 |
tgggcaatatgaggcttataaaatctgcataaggtttcacattttcaaacttaccaggtttcaaaagaactatgaacctcaatgagctgaaatgctactc |
214 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24361676 |
tgggcaataagaggtttataaaatctgcataaggtttcacattttcaaacttaacaggtttcaaaagaactatgaacctcaatgagctgaaatgctactc |
24361775 |
T |
|
| Q |
215 |
atatgaa |
221 |
Q |
| |
|
||||||| |
|
|
| T |
24361776 |
atatgaa |
24361782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University