View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4634_low_11 (Length: 220)
Name: NF4634_low_11
Description: NF4634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4634_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 43 - 212
Target Start/End: Original strand, 8016609 - 8016778
Alignment:
| Q |
43 |
atcatcagagataacatatttattagtgtatgacatacgacatacatacccggagggaagagtgtggacataagttggtatcatgggaagcccgggccca |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016609 |
atcatcagagataacatatttattagtgtatgacatacgacatacatacccggagggaagagtgtggacataagttggtatcatgggaagcccgggccca |
8016708 |
T |
 |
| Q |
143 |
tcaacggaggaaagcccagcccgcatttcagaagacattgcatcagcaacatggtgaagaagaggtagag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016709 |
tcaacggaggaaagcccagcccgcatttcagaagacattgcatcagcaacatggtgaagaagaggtagag |
8016778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University