View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4634_low_11 (Length: 220)

Name: NF4634_low_11
Description: NF4634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4634_low_11
NF4634_low_11
[»] chr1 (1 HSPs)
chr1 (43-212)||(8016609-8016778)


Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 43 - 212
Target Start/End: Original strand, 8016609 - 8016778
Alignment:
43 atcatcagagataacatatttattagtgtatgacatacgacatacatacccggagggaagagtgtggacataagttggtatcatgggaagcccgggccca 142  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8016609 atcatcagagataacatatttattagtgtatgacatacgacatacatacccggagggaagagtgtggacataagttggtatcatgggaagcccgggccca 8016708  T
143 tcaacggaggaaagcccagcccgcatttcagaagacattgcatcagcaacatggtgaagaagaggtagag 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8016709 tcaacggaggaaagcccagcccgcatttcagaagacattgcatcagcaacatggtgaagaagaggtagag 8016778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University