View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4635-Insertion-11 (Length: 177)
Name: NF4635-Insertion-11
Description: NF4635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4635-Insertion-11 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 8 - 177
Target Start/End: Original strand, 39753763 - 39753932
Alignment:
| Q |
8 |
gatatcactgcaatttttgacaaatctattgtattatacaccaattgctattattgcttcagtgattctctctgctctacctggactcatagacataaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753763 |
gatatcactgcaatttttgacaaatctattgtattatacaccaattgctattattgcttcagtgattctctctgctctacctggactcatagacataaat |
39753862 |
T |
|
| Q |
108 |
gaagcttacaaaatttggaaagttgataagcttgactttcttgcttgtgctggtgctttctttggtgtac |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753863 |
gaagcttacaaaatttggaaagttgataagcttgactttcttgcttgtgctggtgctttctttggtgtac |
39753932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 118 - 172
Target Start/End: Original strand, 39745350 - 39745404
Alignment:
| Q |
118 |
aaatttggaaagttgataagcttgactttcttgcttgtgctggtgctttctttgg |
172 |
Q |
| |
|
|||||||||| |||||||| |||| ||||||||||||||||| || |||||||| |
|
|
| T |
39745350 |
aaatttggaaggttgataaaattgattttcttgcttgtgctggagccttctttgg |
39745404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University