View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4635-Insertion-14 (Length: 125)
Name: NF4635-Insertion-14
Description: NF4635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4635-Insertion-14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 31168673 - 31168556
Alignment:
| Q |
8 |
cttgccagctcccataccaccgcccatgaaaaggagcactgggctcctatcactgtgagccactggtgtcatcacctctgtgcagcgattttcgtcattt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31168673 |
cttgccagctcccataccaccgcccatgaaaaggagcacagggctcctatcactgtgagccactggtgccatcacctctgtgcagcgattttcgtcattt |
31168574 |
T |
|
| Q |
108 |
gatacaagtcccattgct |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31168573 |
gatacaagtcccattgct |
31168556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 38628540 - 38628620
Alignment:
| Q |
8 |
cttgccagctcccataccaccgcccatgaaaaggagcactgggctcctatcactgtgagccactggtgtcatcacctctgt |
88 |
Q |
| |
|
|||||||||||||||||| || ||||| | ||| || ||||||||||||||||||||||| || || | ||| |||||||| |
|
|
| T |
38628540 |
cttgccagctcccatacctcctcccatcagaagtaggactgggctcctatcactgtgagctacgggagccattacctctgt |
38628620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University