View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4635_high_2 (Length: 253)
Name: NF4635_high_2
Description: NF4635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4635_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 22 - 231
Target Start/End: Complemental strand, 44553767 - 44553558
Alignment:
| Q |
22 |
aaagaagtgtagcaccaacaccaacaccggcggtagtaccaatatcagtggtacaagttaacacaacgccgccgccagcacaaccacctccggttagcaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44553767 |
aaagaagtgtagcaccaacaccaacaccggcggtagtaccaatatctgtggtacaagttaacacaacgccgccgccagcacaaccacctccggttagcaa |
44553668 |
T |
 |
| Q |
122 |
gttaggcacaacaatagtcccgcagcaacaacaacaacaattggtgacgaatatggaaattgtgaaagttgataacaatggcgagactttcatgggaggg |
221 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44553667 |
gttaggcacaacaatagtccagcagcaacaacaacaacaattggtgacgaatatggaaattgtgaaagttgataacaatggcgagactttcatgggaggg |
44553568 |
T |
 |
| Q |
222 |
atgagttcgt |
231 |
Q |
| |
|
|||||||||| |
|
|
| T |
44553567 |
atgagttcgt |
44553558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University