View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4636-Insertion-11 (Length: 165)
Name: NF4636-Insertion-11
Description: NF4636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4636-Insertion-11 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 8e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 8e-72
Query Start/End: Original strand, 8 - 165
Target Start/End: Complemental strand, 16690374 - 16690215
Alignment:
| Q |
8 |
ataacttgcagtgtaagtaagtgagtttaactatctattttacattgttttct--atgatgcaatattaatcttacaggggagtcccatttcactaaatg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16690374 |
ataacttgcagtgtaagtaagtgagtttaactatctattttacattgttttcttcatgatgcaatattaatcttacaggggagtcccatttctctaaatg |
16690275 |
T |
|
| Q |
106 |
ttctctggaatccactgaatcatgattgtaactgtctcataaccgtttttctattgcgta |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
16690274 |
ttctctggaatccactgaatcatgattgtaactgtctcataatcgtttttctgttgcgta |
16690215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 129 - 156
Target Start/End: Original strand, 16690563 - 16690590
Alignment:
| Q |
129 |
gattgtaactgtctcataaccgtttttc |
156 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
16690563 |
gattgtaactgtctcataaccgtttttc |
16690590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University