View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4636_high_7 (Length: 322)
Name: NF4636_high_7
Description: NF4636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4636_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 36063580 - 36063265
Alignment:
| Q |
1 |
ctgacaactgaggaagctatttgtgtgacaaattaaagtctcttactctcttttaaattgaattttgatcatatttttgcaatgaaaatatgtaatttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36063580 |
ctgacaactgaggaagctatttgtgtgacaaattaaagtctcttactctcttttaaattaaattttgatcatatttttgcaatgaaaatatgtaatttta |
36063481 |
T |
|
| Q |
101 |
acaagcaattatttttgcacaccttcatttttcctacactaattcaacacttcattttctttctatctttatattcatatcacatcaccaatttactact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36063480 |
acaagcaattatttttgcacaccttcatttttcctacactaattcaatacttcattttctctctatcttaatattcatatcacatcaccaatttactact |
36063381 |
T |
|
| Q |
201 |
tttatcacatcagtttctttatttctctctagtgataaattgaggtttgagtgtctaagaatcattttccattttaatattgatgcaatatgctcaacgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36063380 |
tttatcacatcagtttctttatttctctctagtgataaattgaggtttgagtgtctaagaatcattttccattttaatattgatgcaatatgctcaacgt |
36063281 |
T |
|
| Q |
301 |
actctttctatgatac |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36063280 |
actctttctatgatac |
36063265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University