View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4637-Insertion-10 (Length: 215)
Name: NF4637-Insertion-10
Description: NF4637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4637-Insertion-10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 202
Target Start/End: Original strand, 39558590 - 39558778
Alignment:
| Q |
15 |
ctaacaaactatgcaa-ctaaaacactattttgtattactttattaattaaatatatttgttatttgcatgatagcttccccctgatttagcctttttaa |
113 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39558590 |
ctaacaaactatgcaaactaaaacactattttgtattactttattaattaaatatatttgttatttgcatggtagcttccccctgatttagcctttttaa |
39558689 |
T |
|
| Q |
114 |
gattctgcagattttgtgtcccatgcatgattgttcgtgagatgacatatacactctttcttaaattactaagcatcaaatgatcgcaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39558690 |
gattctgcagattttgtgtcccatgcatgattgttcgtgagatgacatatacactctttcttaaattactaagcatcaaatgatcgcaa |
39558778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University