View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4637-Insertion-12 (Length: 97)
Name: NF4637-Insertion-12
Description: NF4637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4637-Insertion-12 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 3e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 3e-39
Query Start/End: Original strand, 8 - 97
Target Start/End: Complemental strand, 34320993 - 34320904
Alignment:
| Q |
8 |
tctttcgctccaaatgtttctggaataaagtcatcaaactgcgataacccttcttttattttggataccaactcatgtaattccatttcc |
97 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34320993 |
tctttcgctccaaatgtttccggaataaagtcaccaaactgcgataacccttcttttattttggataccaactcatgtaattccatttcc |
34320904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 50 - 97
Target Start/End: Complemental strand, 34329859 - 34329812
Alignment:
| Q |
50 |
gataacccttcttttattttggataccaactcatgtaattccatttcc |
97 |
Q |
| |
|
||||||||||||||||||||| ||||||| || | || |||||||||| |
|
|
| T |
34329859 |
gataacccttcttttattttgcataccaaatcctttagttccatttcc |
34329812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 28; Significance: 0.0000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 50 - 81
Target Start/End: Original strand, 36621880 - 36621911
Alignment:
| Q |
50 |
gataacccttcttttattttggataccaactc |
81 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |
|
|
| T |
36621880 |
gataacccttcttttattttgcataccaactc |
36621911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 50 - 97
Target Start/End: Original strand, 36632680 - 36632727
Alignment:
| Q |
50 |
gataacccttcttttattttggataccaactcatgtaattccatttcc |
97 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| || ||||||||| |
|
|
| T |
36632680 |
gataacccttcttttattttgcagaccaactcatctagctccatttcc |
36632727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University