View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4637-Insertion-8 (Length: 375)
Name: NF4637-Insertion-8
Description: NF4637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4637-Insertion-8 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 168 - 375
Target Start/End: Complemental strand, 40192105 - 40191898
Alignment:
| Q |
168 |
gttgtcgccgtctcctgccaccgttgatgatggtttcacacgagaacaacagcataccaataatgggtatgagtcagattctgatttggtgaaccttaag |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40192105 |
gttgtcgccgtctcctgccaccgttgatgatggtttcacacgagaacaacagcataccaataatgggtatgagtcagattctgatttggtgaaccttaag |
40192006 |
T |
|
| Q |
268 |
attagtttgttgggtgattgccatattgggaaaactacttttttggtaagcaagttttttactttaccttaaatgttgaaatgggtcatgtgtagatttt |
367 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40192005 |
attagtttgttgggtgattgtcatattgggaaaactacttttttggtaagcaagttttttactttaccttaaatgttgaaatgggtcatgtgtagatttt |
40191906 |
T |
|
| Q |
368 |
cattttag |
375 |
Q |
| |
|
|||||||| |
|
|
| T |
40191905 |
cattttag |
40191898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 8 - 140
Target Start/End: Complemental strand, 40192262 - 40192130
Alignment:
| Q |
8 |
aggttgacgttaaatatggtatgcttcaaagggtatcttttgttggtcagttttttaggttcatttggaataaacttatggtttgttctgttggaagatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40192262 |
aggttgacgttaaatatggtatgcttcaaagggtatcttttgttggtcagttttttaggttcatttggaataaacttatggtttgttctgttggaagatc |
40192163 |
T |
|
| Q |
108 |
accagctcaatatagaagattatctcttaatca |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40192162 |
accagctcaatatagaagattatctcttaatca |
40192130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 325
Target Start/End: Original strand, 36886050 - 36886091
Alignment:
| Q |
284 |
attgccatattgggaaaactacttttttggtaagcaagtttt |
325 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
36886050 |
attgccatattgggaaaattacttggttggtaagcaagtttt |
36886091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University