View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4637-Insertion-9 (Length: 279)
Name: NF4637-Insertion-9
Description: NF4637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4637-Insertion-9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 7 - 273
Target Start/End: Complemental strand, 4066053 - 4065785
Alignment:
| Q |
7 |
aaatatttcgttacaacagcacaactattttaattttaaataagaaaaggttcttacgatattcattggagtgaattagaaatatcaactaaacgtcttc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4066053 |
aaatatttcgttacaacagcacaactattttaattttaaataagaaaaggttcttacgatattcattggagtgaattagaaatatcaactaaacgtcttc |
4065954 |
T |
 |
| Q |
107 |
tttttttaataa-atgaaaggagnnnnnnnnnnnnn-actgataaaaaggtgcttatgatttctatgggatgaattccaagtagcaaccgataaaacaga |
204 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065953 |
tttttttaataatatgaaaggagttttttgtttttttactgataaaaaggtgcttatgatttctatgggatgaattccaagtagcaaccgataaaacaga |
4065854 |
T |
 |
| Q |
205 |
gttaatgtaaacttttctggacacggtactctagtcccatagacaattcagcataattacacatcaaat |
273 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065853 |
gttaatgtaaacttttctggacatagtactctagtcccatagacaattcagcataattacacatcaaat |
4065785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University