View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4637_low_1 (Length: 250)
Name: NF4637_low_1
Description: NF4637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4637_low_1 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 79 - 250
Target Start/End: Complemental strand, 25473837 - 25473654
Alignment:
| Q |
79 |
tgatattgcagaaaatttcagtgaaactctagtagaagtgacatcaaaactttgatgttt------------acaaattcaaacattttagtaaaacctt |
166 |
Q |
| |
|
|||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25473837 |
tgatgttgcataaaattccagtgaaactctagtagaagtgacatcaaaactttgatgttgttgtggccacaaacaaattcaaacattttagtaaaacctt |
25473738 |
T |
 |
| Q |
167 |
gatgagaatgtcaatatgtcatagatttgatttggtgaattttttccttgtcaaatgttttggttgtagatcttttacaaggtt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25473737 |
gatgagaatgtcaatatgtcatagatttgatttggtgaattttttccttgtcaaatgttttggttgtagatcttttacaaggtt |
25473654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 95
Target Start/End: Complemental strand, 25473930 - 25473853
Alignment:
| Q |
18 |
ctttttatatgataatcaaggtttttaaccacggtaaagttaagacacaatagttgataattgatattgcagaaaatt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25473930 |
ctttttatatgataatcaaggtttttaaccacggtaaagttaagacacaatagttgataattgatattgcagaaaatt |
25473853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University