View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4638-Insertion-17 (Length: 207)
Name: NF4638-Insertion-17
Description: NF4638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4638-Insertion-17 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 8 - 207
Target Start/End: Original strand, 55178917 - 55179116
Alignment:
| Q |
8 |
actttcatctcttctttaaatgtttcttcctcccattttctgttaccttcttggcttttcgatttctcatcctcattctccgagtggtctgtgccagatg |
107 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55178917 |
actttcatttctcctttaaatgtttcttcctcccattttctgttaccttcttggcttttcgatttctcatcctcattctctgagtggtctgtgccagatg |
55179016 |
T |
 |
| Q |
108 |
cagactggaccaccgtgctgataagactcggtctaggatcctctataatgccacttagcataatcatattcatagttggaaacaaatttgctatagtaga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55179017 |
cagactggaccaccgtgctgataagactcggtctaggatcctctataatgccacctagcataatcatattcatagttggaaacaaatttgctatagtaga |
55179116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University