View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4638-Insertion-8 (Length: 470)
Name: NF4638-Insertion-8
Description: NF4638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4638-Insertion-8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 455; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 455; E-Value: 0
Query Start/End: Original strand, 8 - 470
Target Start/End: Original strand, 40153913 - 40154375
Alignment:
| Q |
8 |
ccaatgtataatcaggttcgaccactttcttcacaaccttcttcctgctccgtaaacgcttcagaaaaggcgagaagaaacaacctgacgaagtcacgca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40153913 |
ccaatgtataatcaggttcgaccactttcttcacaaccttcttcctgctccgtaaacgcttcagaaaaggcgagaagaaacaacctgacgaagtcacgca |
40154012 |
T |
 |
| Q |
108 |
ctctggttgtgcaagaagaggccgttcaaaccgccatcgttcagaaccgaccttaggacttgaccggaaggagcgtgtacggggctccaccggagataac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40154013 |
ctctggttgtgcaagaagaggccgttcaaaccgccatcgttcagacccgaccttaggacttgaccggaaggagcgtgtacggggctccaccggagataac |
40154112 |
T |
 |
| Q |
208 |
ttgtaggatccgagttgtggcggaggtttgagcttgaatgagggagattccgggttttgatgatgatggtgaggaatggggagtcctggtttgatttacc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40154113 |
ttgtaggatccgagttgtggcggaggtttgagcttgaatgagggagattccgggttttgatgatgatggtgaggaatggggagtcctggtttgatttccc |
40154212 |
T |
 |
| Q |
308 |
atttgaatggaactgatcctggttttttgaaagaataatcttccgccactaccattgttttgaatttgattgttgcaatatgtgagtggatgcatttatt |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40154213 |
atttgaatggaactgatcctggttttttgaaagaataatcttccgccactaccattgttttgaatttgattgttgcaatatgtgagtggatgcatttatt |
40154312 |
T |
 |
| Q |
408 |
aacgttgtatatgagttacagtgcttgcgaaatcaaaggcatggattagtggggactcttcag |
470 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40154313 |
aacgttgtatatgagttacagtgcttgcgaaatcaaaggcatggattagtggggactcttcag |
40154375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University