View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4639-Insertion-14 (Length: 58)

Name: NF4639-Insertion-14
Description: NF4639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4639-Insertion-14
NF4639-Insertion-14
[»] chr1 (2 HSPs)
chr1 (6-58)||(12490533-12490585)
chr1 (9-52)||(12505081-12505124)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 3e-22; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 6 - 58
Target Start/End: Original strand, 12490533 - 12490585
Alignment:
6 cagctatggcctccctttcatcggaccgatcttcgaccgacacgactacttct 58  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
12490533 cagctatggcctccctttcatcggaccgatcttcgaccgacacgactacttct 12490585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 12505081 - 12505124
Alignment:
9 ctatggcctccctttcatcggaccgatcttcgaccgacacgact 52  Q
    ||||||||||||||||||||||||||| || |||||||| ||||    
12505081 ctatggcctccctttcatcggaccgattttggaccgacatgact 12505124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University