View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4639-Insertion-14 (Length: 58)
Name: NF4639-Insertion-14
Description: NF4639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4639-Insertion-14 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 3e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 6 - 58
Target Start/End: Original strand, 12490533 - 12490585
Alignment:
| Q |
6 |
cagctatggcctccctttcatcggaccgatcttcgaccgacacgactacttct |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12490533 |
cagctatggcctccctttcatcggaccgatcttcgaccgacacgactacttct |
12490585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 12505081 - 12505124
Alignment:
| Q |
9 |
ctatggcctccctttcatcggaccgatcttcgaccgacacgact |
52 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
12505081 |
ctatggcctccctttcatcggaccgattttggaccgacatgact |
12505124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University