View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4641_low_1 (Length: 253)
Name: NF4641_low_1
Description: NF4641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4641_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 28190847 - 28190602
Alignment:
| Q |
1 |
tatggattgtttagaagtccacaagtgaccttcttctcaaagggtaccctaaacaacttcatttgctcctccctcatatttcttagtaagtcagggttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28190847 |
tatggattgtttagaagtccacaagtgaccttcttctcaaagggtaccctaaacaacttcatttgctcctccctcatatttcttagtaagtcagggttta |
28190748 |
T |
|
| Q |
101 |
taccatggtttatcacttggaaaaatccccattctgatgcagctttgcatattgctgcagtgcaagctaatctttcacttacattacaacttttaagacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28190747 |
taccatggtttatcacttggaaaaatccccattctgatgcagctttgcatattgctgcagtgcaagctaatctttcacttacattacaacttttaagacc |
28190648 |
T |
|
| Q |
201 |
attaaggtctatcaatggtagttcacattcgaccacagtattatct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28190647 |
attaaggtctatcaatggtagttcacattcgaccacagtattatct |
28190602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University