View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4642-Insertion-4 (Length: 236)
Name: NF4642-Insertion-4
Description: NF4642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4642-Insertion-4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 8 - 171
Target Start/End: Original strand, 31904456 - 31904619
Alignment:
| Q |
8 |
ttctttgcattggagttcgggtgtaatgttttttgtttctgggctggtgctttttatagcaccctcactttgcaactattgtatttgttttgtggtgttt |
107 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
31904456 |
ttctttgcatgggagttcgggtgtaatgttttttgtttctgggctggtgctttttatagcaccctcactttgtaactgttgtatttgttttgtggtgttc |
31904555 |
T |
|
| Q |
108 |
ttccttttgcacatcttgtgcgggttgaaccaccggtgagtaatatatttcattttcatttgtt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31904556 |
ttccttttgcacatcttgtgcgggttgaaccaccggtgagtaatatattccattttcatttgtt |
31904619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 101 - 130
Target Start/End: Complemental strand, 40365805 - 40365776
Alignment:
| Q |
101 |
ggtgtttttccttttgcacatcttgtgcgg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40365805 |
ggtgtttttccttttgcacatcttgtgcgg |
40365776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University