View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4642_high_11 (Length: 321)
Name: NF4642_high_11
Description: NF4642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4642_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 43 - 303
Target Start/End: Complemental strand, 31904383 - 31904123
Alignment:
| Q |
43 |
tgttgtgaaagctaccttataattattcttacattcgcccatgatgagagataatgtaactcaaaaacatactagttgtgtgtgcatgagacatgatgtt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31904383 |
tgttgtgaaagctaccttataattattcttagattcgcccatgatgagagataatgtaactcaaaaacatactagttgtgtgtgcatgagacatgatgtt |
31904284 |
T |
 |
| Q |
143 |
gcacaaccgaattatacagaaattagtttttaaatgaaaatttcacaaaaatcaagggctttggagtctctcacgatttgatagggtattaaggtttagt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
31904283 |
gcacaaccgaattatacagaaattagtttttaaatgaaaatttcacagaaatcaagggctttggagtctatcacggtttgatagggtattagggtttagt |
31904184 |
T |
 |
| Q |
243 |
gttcttttgagctttcaaacacaacaaatcatagtttcaatttatctttagattcaccaca |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31904183 |
gttcttttgagctttcaaacacaacaaatcatagtttcaattcatctttagattcaccaca |
31904123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 31904460 - 31904421
Alignment:
| Q |
1 |
aagaagcgggtgcttacacccactcatgataactataggc |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31904460 |
aagaagcgggtgcttacacccactcatgataaccataggc |
31904421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University