View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4643-Insertion-8 (Length: 186)
Name: NF4643-Insertion-8
Description: NF4643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4643-Insertion-8 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 8 - 186
Target Start/End: Original strand, 44270768 - 44270933
Alignment:
| Q |
8 |
actactagttgccactaattaagtttgaagtcaaaaattggttaaaggggctggtgtgatgattgactccaagttaagtcatttaaaacccaaaatatat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
44270768 |
actactagttgccactaattaagtttgaagtcaaaaaat------------tggtgtgatgattgactccaagttaagccatttaaaacccaaaa-atat |
44270854 |
T |
 |
| Q |
108 |
ggtattggttttacctactacgtactaaaacagatcatatacttattgcatggaaaccacactcataataactataata |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44270855 |
ggtattggttttacctactacgtactaaaacagatcatatacttattgcatggaaaccacactcataataactacaata |
44270933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University