View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4643_low_1 (Length: 251)
Name: NF4643_low_1
Description: NF4643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4643_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 42 - 197
Target Start/End: Complemental strand, 1189440 - 1189289
Alignment:
| Q |
42 |
gaagcataggtccaatgaaaatgtgtgttggtctgatggaatctaaattatagagttttata-atcaccgttatttgtcacaagcaatgattatattgac |
140 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
1189440 |
gaagcacaggtccaatgaaaatgtgtgttggtctgatggaatctaaattatagagttttatagatcaccgttatttgtcacaagcaatgatt-----gac |
1189346 |
T |
 |
| Q |
141 |
taatactctggagtaaattttgtgaaattttttagttaaaaatgtgattacagtact |
197 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1189345 |
taatactatggagtaaattttgtgaaattttttagttaaaaatgtgattacagtact |
1189289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 187
Target Start/End: Original strand, 41762223 - 41762253
Alignment:
| Q |
157 |
attttgtgaaattttttagttaaaaatgtga |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41762223 |
attttgtgaaattttttagttaaaaatgtga |
41762253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University