View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4644-Insertion-15 (Length: 174)
Name: NF4644-Insertion-15
Description: NF4644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4644-Insertion-15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 6054800 - 6054645
Alignment:
| Q |
7 |
agcaacatcatgcgtgatacactttcttttcactccaaacatgagatgacacattgacaccccaaatatacttgaataccaaattgaagtataaaatgct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6054800 |
agcaacatcatgcgtgatacactttcttttcactccaaacatgagatgacacattgacaccccaaatatacttgaataccaaattgaagtataaaatgct |
6054701 |
T |
 |
| Q |
107 |
ataatagcatgaaattattagtataagatatgctgtgatatgcaccctcttgagga |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6054700 |
ataatagcatgaaattattagtataagatatgctgtgatatgcaccctcttgagga |
6054645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University