View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4644-Insertion-16 (Length: 142)
Name: NF4644-Insertion-16
Description: NF4644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4644-Insertion-16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 2e-41; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 45040577 - 45040460
Alignment:
| Q |
8 |
tggaattcattcaaaaatcccacgaagtcaaactacaagagaaccaatatgttcgaaataaagtaaaactacgatagaaccaatatagacttgacataac |
107 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||||||||||||||| | |||||||||||||||| | ||||| ||||||||||||||||||| |
|
|
| T |
45040577 |
tggaattcattcaaaaatctcatgaagtcaaactaaaagagaaccaatatgttgggaataaagtaaaactacaagagaactaatatagacttgacataac |
45040478 |
T |
|
| Q |
108 |
aatttgttgaggtgtcta |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45040477 |
aatttgttgaggtgtcta |
45040460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 4e-27
Query Start/End: Original strand, 68 - 141
Target Start/End: Complemental strand, 45041484 - 45041411
Alignment:
| Q |
68 |
aagtaaaactacgatagaaccaatatagacttgacataacaatttgttgaggtgtctactgaattgattggttt |
141 |
Q |
| |
|
|||| ||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45041484 |
aagtcaaactacaagagaaccaatatagacttgacataacaatttgttgaggtgtctactgaattgattggttt |
45041411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 45041508 - 45041459
Alignment:
| Q |
8 |
tggaattcattcaaaaatcccacgaagtcaaactacaagagaaccaatat |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45041508 |
tggaattcattcaaaaatcccacgaagtcaaactacaagagaaccaatat |
45041459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University