View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4644_high_14 (Length: 298)
Name: NF4644_high_14
Description: NF4644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4644_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 35 - 131
Target Start/End: Complemental strand, 3854996 - 3854900
Alignment:
| Q |
35 |
tcgttgggattggttgaagaagttcatccgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatattaacaacaac |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3854996 |
tcgttgggattggttgaagaagttcatccgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatattagcaacaac |
3854900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 210 - 288
Target Start/End: Complemental strand, 3854833 - 3854755
Alignment:
| Q |
210 |
ggaggaggaggctatggattaagcgttgatgatcataattcattgcatccacaatttgttcccaactgcaatgcctttg |
288 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
3854833 |
ggaggaggaggctatggatcaagcgttgatgatcataattcattgcatccacaatttgtccccaactgcaatgtctttg |
3854755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 31 - 123
Target Start/End: Original strand, 4141638 - 4141730
Alignment:
| Q |
31 |
attatcgttgggattggttgaagaagttcatccgcgcctgcccctctcttcaaagtattgtaattcataaggtttgttaactttatcatatta |
123 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
4141638 |
attatcattgggattggttgaagaaattcatccgcgcctgcccctctcttcaaagtattgtgattcataaggtttgttaactctatcatatta |
4141730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 205 - 288
Target Start/End: Original strand, 4141819 - 4141902
Alignment:
| Q |
205 |
tcggaggaggaggaggctatggattaagcgttgatgatcataattcattgcatccacaatttgttcccaactgcaatgcctttg |
288 |
Q |
| |
|
|||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4141819 |
tcggaggaggagtaggttatggattaagcggcgatgatcataattcattgcatccacaatttgtccccaactgcaatgcctttg |
4141902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University