View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4644_high_24 (Length: 239)
Name: NF4644_high_24
Description: NF4644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4644_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 9311452 - 9311244
Alignment:
| Q |
1 |
ttattccatcatgtgcattataatttttcaaacgtttgtagactannnnnnn-agtattttattgattgaaatcacgtgactttgaggacatcaaaagaa |
99 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9311452 |
ttattccatcacgtgcattataatttttcaaacgtttgtagactattttttatagtattttattgattgaaatcacgtgactttgaggacatcaaaagaa |
9311353 |
T |
 |
| Q |
100 |
aactgcaaacacaagcttgatggtccaagtaggat-----aatgaatatacagcacataattgttaaaatcaaatagtttggattttcgtctctcttgtg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9311352 |
aactgcaaacacaagcttgatggtccaagtaggattaacaaatgaatatacagcacataattgttaaaatcaaatagtttggattttcgtctctcttgtg |
9311253 |
T |
 |
| Q |
195 |
atggtccaa |
203 |
Q |
| |
|
||||||||| |
|
|
| T |
9311252 |
atggtccaa |
9311244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University