View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4644_high_7 (Length: 433)
Name: NF4644_high_7
Description: NF4644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4644_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 7e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 18 - 148
Target Start/End: Complemental strand, 34893416 - 34893286
Alignment:
| Q |
18 |
gttactatgtcttaatgatctagattgttaataaggtttgaattattaagattttcattctatattttgtcgaattttataagtgtttacagtgattttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
34893416 |
gttactatgtcttaatgatctagattgttaataaggtttgaatgattaagattttcattctatattttatcgaattttattagtgtttacagtgattttt |
34893317 |
T |
 |
| Q |
118 |
ggttaactatgaagtgtgtcaaaccaatcac |
148 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |
|
|
| T |
34893316 |
ggttaactataaagtgtgtcaaacctatcac |
34893286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 101 - 143
Target Start/End: Original strand, 31763600 - 31763642
Alignment:
| Q |
101 |
tgtttacagtgatttttggttaactatgaagtgtgtcaaacca |
143 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
31763600 |
tgtttgcagtgatttttggttaattatgaagtgtgccaaacca |
31763642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University