View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4644_high_9 (Length: 408)
Name: NF4644_high_9
Description: NF4644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4644_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 88 - 279
Target Start/End: Original strand, 30217281 - 30217472
Alignment:
| Q |
88 |
attcgaatttgtgtgtgtgataaagcaaagcatatagtagtactttggtcattcattcattccttgcccctcccatattgtttgtgttcttttctttcac |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30217281 |
attcgaatttgtgtgtgtgataaagcaaagcatatagtagtactttggtcattcattcattccttgcccctcccatattgtttgtgttcttttctttcac |
30217380 |
T |
|
| Q |
188 |
tgcttttaattaagtatataggcccattgtttccttcttttgagatttttgagatcacttttgatcttgctctaatcccgagctagcttccc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30217381 |
tgcttttaattaagtatataggcccattgtttccttcttttgagatttttgagatcacttttgatcttgctctaatcccgagctagcttccc |
30217472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 349 - 392
Target Start/End: Original strand, 30217543 - 30217586
Alignment:
| Q |
349 |
ctctttttgtattatgcttattttgcattttaactcttgttagt |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30217543 |
ctctttttgtattatgcttattttgcattttaactcttgttagt |
30217586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University