View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4644_low_17 (Length: 276)
Name: NF4644_low_17
Description: NF4644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4644_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 4187544 - 4187803
Alignment:
| Q |
1 |
ttttggatatctatttttgttcatttctcattacccctaaacagctaaaccaacccatgtgatagaagattaatgcaatgtacgatacataataatgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4187544 |
ttttggatatctatttttgttcatttctcattacccctaaacagctaaaccaacccatgtgatagaagattaatgcaatgtacgatacataatagtgcaa |
4187643 |
T |
 |
| Q |
101 |
tccaaataaacacgttttctttaccgtagaatttgagtatatattagctagttaggcacttcccattatggaacaatttacgaccctgacctatctcttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4187644 |
tccaaataaacacgttttctttaccgtagaatttgag----tattagctagttaggcacttcccattatggaacaattgacgaccctgacctatctcttt |
4187739 |
T |
 |
| Q |
201 |
gacataagaatatggcatcaacatcattactacatgcatgtttgtagagacctttattcatctc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4187740 |
gacataagaatatggcatcaacatcattactacatgcatgtttgtagagacctttattcatctc |
4187803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University