View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4644_low_23 (Length: 242)
Name: NF4644_low_23
Description: NF4644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4644_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 9311788 - 9312024
Alignment:
| Q |
1 |
gcaatctttacttcctaacaagcaacggtcatatatccttgaaatctagccacatgtcccacacctgcagccaaatctagaacaagaaaaactcagtcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9311788 |
gcaatctttacttcctaacaagcaacggtcatatatccttgaaatctagccacatgtcccacacctgcagccaaatctagaacaagaaaaactcagccat |
9311887 |
T |
 |
| Q |
101 |
tgctctagtttgggccaataaaaatccacctacccacttttatggcactactgcacggggcataggtggacatga-ctttttagtctacaaaattgtaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
9311888 |
tgctctagtttgggccaataaaaatccacctacccacttttatggcactactgcacggggcacaggtcgacatgatttttttagtctacaaaattgtaat |
9311987 |
T |
 |
| Q |
200 |
acaatagttaaggagaattggtccatgtgatctgtgg |
236 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
9311988 |
acaatagccaaggagaattggtccatctgatctgtgg |
9312024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University