View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4644_low_28 (Length: 211)
Name: NF4644_low_28
Description: NF4644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4644_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 4605300 - 4605166
Alignment:
| Q |
1 |
ccgtagaaatttttccacaggtttcattattagctcctcactggccaaagcttttagcattccaaaacctatttacttttcatgtattaac-aatttcat |
99 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4605300 |
ccgtagaaattcttccacaggtttcattattagctcctcactggccaaagcttttagcatcccaaaacctatttacttttcatgtattaacaaatttcat |
4605201 |
T |
 |
| Q |
100 |
gaagttatagatattttttcatgtattaaagtctc |
134 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4605200 |
gaagttatagatatttttttatgtattaaagtctc |
4605166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University