View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4645-Insertion-11 (Length: 59)
Name: NF4645-Insertion-11
Description: NF4645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4645-Insertion-11 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 50; Significance: 2e-20; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 10 - 59
Target Start/End: Original strand, 12725914 - 12725963
Alignment:
| Q |
10 |
gtccaggacctacattggtaactcttctcctgaaaactcctattgttgtg |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12725914 |
gtccaggacctacattggtaactcttctcctgaaaactcctattgttgtg |
12725963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 7e-20
Query Start/End: Original strand, 9 - 57
Target Start/End: Complemental strand, 34294526 - 34294478
Alignment:
| Q |
9 |
ggtccaggacctacattggtaactcttctcctgaaaactcctattgttg |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34294526 |
ggtccaggacctacattggtaactcttctcctgaaaactcctattgttg |
34294478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University