View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4645-Insertion-12 (Length: 72)
Name: NF4645-Insertion-12
Description: NF4645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4645-Insertion-12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 1e-28; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 8 - 71
Target Start/End: Original strand, 44087848 - 44087911
Alignment:
| Q |
8 |
gtttactcaacttcgtcaacttgttctagacaatgtggcgaagatggagaattgcggtgatgat |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44087848 |
gtttactcaacttcgtcaacttgttctagacaatgtggcgaagatggagaattgcggtgatgat |
44087911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 44079870 - 44079932
Alignment:
| Q |
8 |
gtttactcaacttcgtcaacttgttctagacaatgtggcgaagatggagaattgcggtgatga |
70 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44079870 |
gtttattcaacttcgtcaacttgttctagacaatgtggcgaagatggagaattgcggtgatga |
44079932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 70
Target Start/End: Original strand, 44067860 - 44067907
Alignment:
| Q |
23 |
tcaacttgttctagacaatgtggcgaagatggagaattgcggtgatga |
70 |
Q |
| |
|
||||||| || |||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
44067860 |
tcaacttattttagacaatatggcgaagatggacaattgtggtgatga |
44067907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University