View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4645-Insertion-14 (Length: 98)
Name: NF4645-Insertion-14
Description: NF4645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4645-Insertion-14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 61 - 98
Target Start/End: Original strand, 44934679 - 44934716
Alignment:
| Q |
61 |
cctaatattttaagaaccgcacaagttggactatgcag |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44934679 |
cctaatattttaagaaccgcacaagttggactacgcag |
44934716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University