View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4645-Insertion-7 (Length: 181)
Name: NF4645-Insertion-7
Description: NF4645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4645-Insertion-7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 8 - 157
Target Start/End: Original strand, 52564686 - 52564835
Alignment:
| Q |
8 |
ctcccttcaattctctcagccttgattattttatttgtctatgcatccttcaaccaatatgataccaccaccttatcgccattcaatatcttcgtccgtc |
107 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52564686 |
ctcccttcaattctctcagcctcgattattttatgtgtctatgcatccttcaaccaatatgataccaccaccttatcgccattcaatatcttcgtccgtc |
52564785 |
T |
|
| Q |
108 |
atgcctcttgatcttaatcaagatcaaaacaatgacctttctagtccaaa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52564786 |
atgcctcttgatcttaatcaagatcaaaaccatgacctttctagtccaaa |
52564835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University