View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4645-Insertion-8 (Length: 117)
Name: NF4645-Insertion-8
Description: NF4645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4645-Insertion-8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 8 - 117
Target Start/End: Complemental strand, 37380344 - 37380235
Alignment:
| Q |
8 |
gttcttccttcaatttgccaagaaaacctacggtgacaaattacaaattcgtatactgcagtgttgataatacaaaaagcgtattttcacattcatggca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37380344 |
gttcttccttcaatttgccaagaaaacctacggtgacaaattacaaattcgtatactgcagtgttgataatacaaaaagcgtattttcacattcatggca |
37380245 |
T |
 |
| Q |
108 |
gtaactctaa |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
37380244 |
gtaactctaa |
37380235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University