View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4645_high_24 (Length: 244)
Name: NF4645_high_24
Description: NF4645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4645_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 2 - 241
Target Start/End: Original strand, 44622786 - 44623025
Alignment:
| Q |
2 |
catcagaaacatcctgatctgttcgagctactaaagctccaactgaaaacatgcgctttttgagtgattgtttggaaaccaggggttttgcttcagatcg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44622786 |
catcagaaacatcctgatctgttcgagctactaaagctcccactgaaaacatgcgctttttgagtgattgtttggaaaccaggggttttgcttcagatcg |
44622885 |
T |
 |
| Q |
102 |
cagtgaagaaaaactagctgctatgtaatttttcacaggattagagttaacagaagcctccacataagctccagagcataaggacnnnnnnngagaggta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
44622886 |
cagtgaagaaaaactagctgctatgtaatttttcacaggattagagttaacagaagcctccacatgagctccagagcataaggactttttttgagaggta |
44622985 |
T |
 |
| Q |
202 |
cagattgcctgtggcgacagcctgcaaaagtaagtataat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44622986 |
cagattgcctgtggcgacagcctgcaaaagtaagtataat |
44623025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University