View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4645_high_31 (Length: 221)
Name: NF4645_high_31
Description: NF4645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4645_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 47178701 - 47178892
Alignment:
| Q |
18 |
gaaaaatcgcaaaatgctagctgatggcaaagctcaaccattgtggtgttggtggtgatggtggcagtgtcattcatgtgtttttaaactatttgaactg |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47178701 |
gaaaaatcggaaaatgctagctgatggcaaagctcaaccattgtggtgttggtggtgatggtggcagtgtcattcatgtgtttttaaactatttgaactg |
47178800 |
T |
 |
| Q |
118 |
tgtgattgtcctctctatatgcttgttcccacaattgattatgcttttgaattggttggcttgttttttccacacagaactgtttgcctttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47178801 |
tgtgattgtcctctctatatgcttgtgcccacaattgattatgcttttgaattggttggcttgttttttccacacagaactgtttgcctttg |
47178892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University