View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4645_high_31 (Length: 221)

Name: NF4645_high_31
Description: NF4645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4645_high_31
NF4645_high_31
[»] chr3 (1 HSPs)
chr3 (18-209)||(47178701-47178892)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 47178701 - 47178892
Alignment:
18 gaaaaatcgcaaaatgctagctgatggcaaagctcaaccattgtggtgttggtggtgatggtggcagtgtcattcatgtgtttttaaactatttgaactg 117  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47178701 gaaaaatcggaaaatgctagctgatggcaaagctcaaccattgtggtgttggtggtgatggtggcagtgtcattcatgtgtttttaaactatttgaactg 47178800  T
118 tgtgattgtcctctctatatgcttgttcccacaattgattatgcttttgaattggttggcttgttttttccacacagaactgtttgcctttg 209  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47178801 tgtgattgtcctctctatatgcttgtgcccacaattgattatgcttttgaattggttggcttgttttttccacacagaactgtttgcctttg 47178892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University