View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4645_low_18 (Length: 271)
Name: NF4645_low_18
Description: NF4645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4645_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 13 - 254
Target Start/End: Complemental strand, 25166553 - 25166312
Alignment:
| Q |
13 |
gagagaggcgcggttgaaggaggagattgagaagtatagagcttcgaatccgaagattactgagcagtttgctgatttgaaaaggaagttgtatactttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25166553 |
gagagaggcgcggttgaaggaggagattgagaagtatagagcttcgaatccgaagattactgagcagtttgctgatttgaaaaggaagttgtatactttg |
25166454 |
T |
|
| Q |
113 |
tctactgatgattggcagagtttggaaaagtttgagagtggtggttattcgtcgaagaataagaagaagaggtttgagagttttgttcctgtgcctgata |
212 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25166453 |
tctactgatgattggcagagtttggagaagtttgagagtggtggttattcgtcaaagaataagaagaagaggtttgagagttttgttcctgtgcctgata |
25166354 |
T |
|
| Q |
213 |
cgcttcttgagaaagcgaggcaggagcaagagcatgtgactg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25166353 |
cgcttcttgagaaagcgaggcaggagcaagagcatgtgactg |
25166312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 227
Target Start/End: Complemental strand, 2190666 - 2190621
Alignment:
| Q |
182 |
aggtttgagagttttgttcctgtgcctgatacgcttcttgagaaag |
227 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
2190666 |
aggtttgagagttttgttcctgttcctgatactcttcttgagaaag |
2190621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University