View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4645_low_36 (Length: 213)
Name: NF4645_low_36
Description: NF4645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4645_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 3932336 - 3932135
Alignment:
| Q |
1 |
acaatgatcatagaagttaaaggcaaatgggtgaaagcacacaaggcccaataaacaaaatttaacagaccagacataagttggcgtcctgtatataact |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3932336 |
acaatgatcatcgaagttaaaggcaaatgggtgaaagcacacaaggcccgataaacaaaatttaacagaccagacataagttggcgtcctgtatataact |
3932237 |
T |
|
| Q |
101 |
tcttctgttcatttttagttgtaactaagannnnnnnacacataccaagaaaatcaataaattatgttacttttgatagaactctttttcgataatatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3932236 |
tcttctgttcatttttagttgtaactaagatttttttacacataccaagaaaatcaataaattatgttacttttgatagaactcttttttgataatatca |
3932137 |
T |
|
| Q |
201 |
tt |
202 |
Q |
| |
|
|| |
|
|
| T |
3932136 |
tt |
3932135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University