View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4646_low_8 (Length: 215)
Name: NF4646_low_8
Description: NF4646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4646_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 70 - 200
Target Start/End: Original strand, 44516335 - 44516465
Alignment:
| Q |
70 |
gcaggtgtactggggacctccagtcccattccaccttacaaatcacactgtgcttctagtaggatgtggagtgcataacaaaactcggtactggattgtg |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44516335 |
gcaggtgtactggggacctccagtcccattccaccttacaaatcacactgtgcttctagtaggatgtggagtgcataacaaaactcggtactggattgtg |
44516434 |
T |
 |
| Q |
170 |
agaaacacctggggcactaattttggtgatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44516435 |
agaaacacctggggcactaattttggtgatg |
44516465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University