View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4646_low_9 (Length: 202)
Name: NF4646_low_9
Description: NF4646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4646_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 21 - 182
Target Start/End: Original strand, 38564418 - 38564578
Alignment:
| Q |
21 |
ggcaaaaaatgatgatataagttgaactttgtcgaattagataaaaagatgatctcacgtcggcaaacatcaagaaagatgatttgtttatttnnnnnnn |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38564418 |
ggcaaaaaatgatgatataagttgaactttgtcgaactagataaaaagatgatctcacgtgggcaaacatcaagaaagatgatttgtttattt-aaaaaa |
38564516 |
T |
|
| Q |
121 |
ntaaatgaaattcaatgtcaattacaattatacccattagttaaagttgttttggaataaaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38564517 |
ataaatgaaattcaatgtcaattacaattatacccattagttaaagttgttttggaaaaaaa |
38564578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University