View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647-Insertion-1 (Length: 130)
Name: NF4647-Insertion-1
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647-Insertion-1 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 7 - 130
Target Start/End: Complemental strand, 5986924 - 5986800
Alignment:
| Q |
7 |
aatatacaatttcacaggggataagaatagttt-gtccatgaggttttatgttccctgtatgcaagcaaactgagaaaatgatatctcatttaatacgtt |
105 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5986924 |
aatatacaatttcatattggataagaatagtttagtccatgaggttttatgttccctgtatgcaagcaaactaagaaaatgatatctcatttaatacgtt |
5986825 |
T |
|
| Q |
106 |
gaattttttgagttctatgtccctc |
130 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5986824 |
gaattttttgagttctatgtccctc |
5986800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University