View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647-Insertion-20 (Length: 492)
Name: NF4647-Insertion-20
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647-Insertion-20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 8e-93; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 8e-93
Query Start/End: Original strand, 185 - 388
Target Start/End: Original strand, 53035314 - 53035524
Alignment:
| Q |
185 |
atcgataatacgggaagaagaagtatacttgcgagcttcggtatcatcgtggaatatctcaggtggtgccacccgctctggtcgagacgccatcgctaaa |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53035314 |
atcgataatacgggaagaagaagtatacttgcgagcttcggtatcatcgtagaatatctcaggtggtgccacccgctctggtcgagacgccatcgctaaa |
53035413 |
T |
|
| Q |
285 |
accctaaacccacactctcttacccgccgccgcgacaccaaccaacaatcctgtaattcagcgtttggaaat-------aattataattattattttatt |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||| |
|
|
| T |
53035414 |
accctaaacccacactctcttacccgccgccgcgacaccaaccaacaatcctgtaattcagcgtttggaaatttccaaaactaataattattattttatt |
53035513 |
T |
|
| Q |
378 |
tcaaaagaaaa |
388 |
Q |
| |
|
||||||||||| |
|
|
| T |
53035514 |
tcaaaagaaaa |
53035524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 8 - 104
Target Start/End: Original strand, 53035133 - 53035229
Alignment:
| Q |
8 |
ataataccaatgtcaaggagtagtttgggaacaccgtcttcaggtaaagcaagtagctccaatgctcgttctgagagtgaggcctatttgggataat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53035133 |
ataataccaatgtcaaggagtagtttgggaacaccgtcttcaggtaaagcaagtagctccaatgctcgttctgagagtgaggcctatttgagataat |
53035229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 11 - 47
Target Start/End: Complemental strand, 1016394 - 1016358
Alignment:
| Q |
11 |
ataccaatgtcaaggagtagtttgggaacaccgtctt |
47 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| |
|
|
| T |
1016394 |
ataccaatgtcaaggagtagcttaggaacaccgtctt |
1016358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University