View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647-Insertion-31 (Length: 227)
Name: NF4647-Insertion-31
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647-Insertion-31 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 8 - 227
Target Start/End: Complemental strand, 27580559 - 27580337
Alignment:
| Q |
8 |
aaaaccacctcaaagagtctttgaggtatagagaccacatggaagactggtctgaaaatgaacttgacagtt-gtggattgttgttcgaagggatggtaa |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27580559 |
aaaaccacctgaaagagtctttgaggtatagagaccacatggaagactggtctgaaaatgaacttgacagtttgtggattgttgttcgaagggatggtaa |
27580460 |
T |
|
| Q |
107 |
aggaaactgggaagc--aatatcagcagatccgtctaagccactctcaaggaacaaatttccacaagaactagctagaagatgggcaaaggagttcttga |
204 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||| |||| ||||||||||||||| ||||||||||||||||| ||||||| ||||| |
|
|
| T |
27580459 |
aggaaactgggaagcgcaatatcagcagatccgtccaagccactcttgaggagcaaatttccacaagagctagctagaagatgggcgaaggagtccttga |
27580360 |
T |
|
| Q |
205 |
aattgaaaattagcactgcaact |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
27580359 |
aattgaaaattagcactgcaact |
27580337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University