View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647-Insertion-9 (Length: 150)
Name: NF4647-Insertion-9
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647-Insertion-9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 2e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 7 - 150
Target Start/End: Original strand, 54951189 - 54951334
Alignment:
| Q |
7 |
acacttttcatttgatcaaataagcttatataagttagttcaataaattattaatctatctaaccacaagaatcatcgatt-aactgttgggattttgta |
105 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54951189 |
acacttttcatttgatcaaacaagcttatataagttagttcaataaattattaatctatctaaccacaagaatcatcgattcaactgttgggattttgta |
54951288 |
T |
|
| Q |
106 |
ttatgatatttt-tctcacttttatatgcccttcgtccgtttctta |
150 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54951289 |
ttatgatattttatctcacttttatatgcccttcgtccgtttctta |
54951334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University